Journal: EMBO Reports
Article Title: DDB1 engagement defines the selectivity of S656 analogs for cyclin K degradation over CDK inhibition
doi: 10.1038/s44319-025-00448-y
Figure Lengend Snippet: ( A ) Volcano plot representing results of whole genome CRISPR/Cas9 screen performed in EKO OCI-AML1 cells during exposure to 1 μM of S656 compound ( n = 1, around 10 sgRNAs per gene). ( B ) Schematic representation of the Cullin4-RING E3 ubiquitin ligase (CRL4) complex. ( C ) Dose response experiment to determine IC 50 values of S656 in OCI-AML5 cells, in regular media or supplemented by 25 nM of the neddylation inhibitor MLN4924 to prevent CRL-mediated proteolysis. IC 50 values were determined after 4 days of incubation (mean +/− SD, n = 3, biological replicates, t test, P value = 0.0478). ( D ) Quantitative proteome-wide mass spectrometry analysis performed in OCI-AML5 cells exposed to 8 μM of S656 for 5 h (CCNK = cyclin K, n = 3, biological replicates). ( E ) Cyclin K degradation assessment by measuring the mean fluorescence intensity (MFI) of cyclin K eGFP over mCherry by flow cytometry. OCI-AML5 G7 clone was treated for 3 h with 10 μM of the indicated compounds. Results are normalized to fluorescence in DMSO-treated cells (mean +/− SD, n = 5, biological replicates, t test, P value < 0.0001). ( F ) Immunoblot analysis of cyclin K and CDK12 protein levels in OCI-AML5 cells, after exposure to increasing concentrations of HQ461 or S656 for 6 h. Tubulin is used as a loading control. ( G ) Immunoblot analysis of cyclin K protein levels after exposure to HQ461 or S656 (5 μM for 5 h). Where indicated, OCI-AML5 cells were pre-treated 1 h with 500 nM of MLN4924 or MG132. ( H ) Immunoblot analysis of DDB1 and cyclin K protein levels after exposure to S656 (5 μM for 5 h) in OCI-AML5 Cas9 cells expressing inducible ( + DOX) sgRNAs targeting DDB1 or control region AAVS1 . ( I ) Dose response experiment to determine S656 IC 50 values in inducible ( + DOX) OCI-AML5 Cas9 cells expressing two different sgRNAs targeting DDB1 gene or AAVS1 control region (mean +/− SD, 4 days incubation, n = 3, biological replicates, t test, P value = 0.0006 and 0.0118 in sgDDB1 #1 and #2, respectively). See also Appendix Fig. S . .
Article Snippet: Clonal OCI-AML5 cells expressing an inducible Cas9 (Addgene plasmid #50661 (Wang et al, )) were generated and then infected with lentiviruses for constitutive expression of sgRNAs targeting AAVS1 control region (Addgene plasmid #50662 (Wang et al, )) or DDB1 #1 (GGAAAAGACCAACCTCCTGG); #2 (AAAGGCCATCATAGAGACGC).
Techniques: CRISPR, Ubiquitin Proteomics, Incubation, Mass Spectrometry, Fluorescence, Flow Cytometry, Western Blot, Control, Expressing
